Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 2847711
End position: 2847734
Length: 24

DNA sequence
>NC_009613, from 2847711 to 2847734 (24 bp); Flavobacterium psychrophilum JIP02/86 ATTGGCATCGGCTTTGGCTTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2846437-2848593	Sequence	FP2485 - RNA-binding protein (Protein is coded in complementary strand; from 2848593 to 2846437)