Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 284874
End position: 284897
Length: 24

DNA sequence
>NC_009613, from 284874 to 284897 (24 bp); Flavobacterium psychrophilum JIP02/86 GGTGGTGGTGGTGCTGGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284778-284984	Sequence	FP0235 - hypothetical protein (Protein is coded in complementary strand; from 284984 to 284778)