Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 289232
End position: 289259
Length: 28

DNA sequence
>NC_009613, from 289232 to 289259 (28 bp); Flavobacterium psychrophilum JIP02/86 TAATTGATAATTGATAGTTGATAATTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 288864-290093	Sequence	FP0241 aroA 3-phosphoshikimate 1-carboxyvinyltransferase (Protein is coded in complementary strand; from 290093 to 288864)