Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 358918
End position: 358942
Length: 25

DNA sequence
>NC_009613, from 358918 to 358942 (25 bp); Flavobacterium psychrophilum JIP02/86 TCTTTTGTTTTATTTTCGTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 358630-360009	Sequence	FP0296 - outer membrane efflux protein (Protein is coded in complementary strand; from 360009 to 358630)