Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 467903
End position: 467965
Length: 63

DNA sequence
>NC_009613, from 467903 to 467965 (63 bp); Flavobacterium psychrophilum JIP02/86 CTGCAACTGAAGCTGTAGCACCTGCTGCTGAAGCTGCTGCACCTGCTGCTGAAGCTGCTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 467719-468060	Sequence	FP0383 - hypothetical protein (Protein is coded in complementary strand; from 468060 to 467719)