Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 505953
End position: 505976
Length: 24

DNA sequence
>NC_009613, from 505953 to 505976 (24 bp); Flavobacterium psychrophilum JIP02/86 TTTGTTAGGTTGTTAGGTTGTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 504329-505954	Sequence	FP0415 pruA 1-pyrroline-5-carboxylate dehydrogenase (Protein is coded in complementary strand; from 505954 to 504329)