Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 538601
End position: 538625
Length: 25

DNA sequence
>NC_009613, from 538601 to 538625 (25 bp); Flavobacterium psychrophilum JIP02/86 TTTATTATATTTTCTTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 538580-539824	Sequence	FP0444 - major facilitator superfamily transporter (Protein is coded in complementary strand; from 539824 to 538580)