Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 611513
End position: 611537
Length: 25

DNA sequence
>NC_009613, from 611513 to 611537 (25 bp); Flavobacterium psychrophilum JIP02/86 GTTTTGGTTTGTTCTGATTTGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 611204-612517	Sequence	FP0504 - outer membrane efflux protein (Protein is coded in complementary strand; from 612517 to 611204)