Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 917671
End position: 917695
Length: 25

DNA sequence
>NC_009613, from 917671 to 917695 (25 bp); Flavobacterium psychrophilum JIP02/86 TTATTATATTTTTTTATATTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 915727-920100	Sequence	FP0776 - phage tail protein (Protein is coded in complementary strand; from 920100 to 915727)