Sequence retrieval

Genome: Flavobacterium psychrophilum JIP02/86
Start position: 92823
End position: 92852
Length: 30

DNA sequence
>NC_009613, from 92823 to 92852 (30 bp); Flavobacterium psychrophilum JIP02/86 TTTATTAATATCTATTGATATTAATTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 91963-93741	Sequence	FP0071 - hypothetical protein (Protein is coded in complementary strand; from 93741 to 91963)