Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1016240
End position: 1016266
Length: 27

DNA sequence
>NC_009641, from 1016240 to 1016266 (27 bp); Staphylococcus aureus subsp. aureus str. Newman TCAGGGTTGTTAGGGTTGTCAGGGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1016189-1017199	Sequence	NWMN_0918 sspA V8 protease, glutamyl endopeptidase precursor (Protein is coded in complementary strand; from 1017199 to 1016189)