Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1143707
End position: 1143733
Length: 27

DNA sequence
>NC_009641, from 1143707 to 1143733 (27 bp); Staphylococcus aureus subsp. aureus str. Newman CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1142080-1144017	Sequence	NWMN_1040 isdB iron-regulated heme-iron binding protein IsdB (Protein is coded in complementary strand; from 1144017 to 1142080)