Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1384073
End position: 1384096
Length: 24

DNA sequence
>NC_009641, from 1384073 to 1384096 (24 bp); Staphylococcus aureus subsp. aureus str. Newman CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1383971-1384459	Sequence	NWMN_1259 - hypothetical protein
ORF. 1384012-1384374	Sequence	NWMN_1260 mscL large-conductance mechanosensitive channel (Protein is coded in complementary strand; from 1384374 to 1384012)