Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1431319
End position: 1431363
Length: 45

DNA sequence
>NC_009641, from 1431319 to 1431363 (45 bp); Staphylococcus aureus subsp. aureus str. Newman ATTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1431318-1432301	Sequence	NWMN_1300 pstS phosphate ABC transporter phosphate-binding protein PstS (Protein is coded in complementary strand; from 1432301 to 1431318)