Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1564023
End position: 1564052
Length: 30

DNA sequence
>NC_009641, from 1564023 to 1564052 (30 bp); Staphylococcus aureus subsp. aureus str. Newman TTTTGTTTCTGTATTTGTTTCTGTATTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1563199-1564077	Sequence	NWMN_1395 - hypothetical protein (Protein is coded in complementary strand; from 1564077 to 1563199)