Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 1877705
End position: 1877729
Length: 25

DNA sequence
>NC_009641, from 1877705 to 1877729 (25 bp); Staphylococcus aureus subsp. aureus str. Newman TTTTTTCTTTCTTTTTTTATTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1877700-1878185	Sequence	NWMN_1682 tnp transposase (Protein is coded in complementary strand; from 1878185 to 1877700)