Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2013156
End position: 2013200
Length: 45

DNA sequence
>NC_009641, from 2013156 to 2013200 (45 bp); Staphylococcus aureus subsp. aureus str. Newman TCCGTTTTCCGAAAACCCGTTTGCCGATAATCCGTTTTCCGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2012737-2013507	Sequence	NWMN_1805 - hypothetical protein (Protein is coded in complementary strand; from 2013507 to 2012737)