Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2083039
End position: 2083065
Length: 27

DNA sequence
>NC_009641, from 2083039 to 2083065 (27 bp); Staphylococcus aureus subsp. aureus str. Newman ATATATACAATATACACAATATACACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2082635-2083090	Sequence	NWMN_1870 - GntR family regulatory protein (Protein is coded in complementary strand; from 2083090 to 2082635)