Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2148142
End position: 2148165
Length: 24

DNA sequence
>NC_009641, from 2148142 to 2148165 (24 bp); Staphylococcus aureus subsp. aureus str. Newman TCTGGATCTGGTTTTGGATCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2147326-2148597	Sequence	NWMN_1940 sdrH SdrH protein (Protein is coded in complementary strand; from 2148597 to 2147326)