Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2319049
End position: 2319078
Length: 30

DNA sequence
>NC_009641, from 2319049 to 2319078 (30 bp); Staphylococcus aureus subsp. aureus str. Newman CATGTATCTTGATGCATCTTCAGGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2318441-2319634	Sequence	NWMN_2081 - hypothetical protein (Protein is coded in complementary strand; from 2319634 to 2318441)