Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2494909
End position: 2494953
Length: 45

DNA sequence
>NC_009641, from 2494909 to 2494953 (45 bp); Staphylococcus aureus subsp. aureus str. Newman TTATTATTCGCTTGGTTATTACTTGATTGGTTATTATTTGTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2494588-2495217	Sequence	NWMN_2270 - hypothetical protein (Protein is coded in complementary strand; from 2495217 to 2494588)