Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2781239
End position: 2781292
Length: 54

DNA sequence
>NC_009641, from 2781239 to 2781292 (54 bp); Staphylococcus aureus subsp. aureus str. Newman GAATCGCTATCTGAATCTGAATCGCTATCTGAATCTGAATCGCTATCTGAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2780453-2783194	Sequence	NWMN_2529 clfB clumping factor B precursor (Protein is coded in complementary strand; from 2783194 to 2780453)