Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 2806008
End position: 2806043
Length: 36

DNA sequence
>NC_009641, from 2806008 to 2806043 (36 bp); Staphylococcus aureus subsp. aureus str. Newman TGGATCTTCCGATGTATCTTTCGATGCATCTTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2804716-2806623	Sequence	NWMN_2545 - hypothetical protein (Protein is coded in complementary strand; from 2806623 to 2804716)