Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 449313
End position: 449336
Length: 24

DNA sequence
>NC_009641, from 449313 to 449336 (24 bp); Staphylococcus aureus subsp. aureus str. Newman GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448640-449851	Sequence	NWMN_0399 hsdS type I restriction modification system, site specificity determination subunit