Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus str. Newman
Start position: 604178
End position: 604231
Length: 54

DNA sequence
>NC_009641, from 604178 to 604231 (54 bp); Staphylococcus aureus subsp. aureus str. Newman TCAGATAGCGACTCAGACTCAGATAGCGACTCAGACTCAGATAGCGACTCAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 601668-604511	Sequence	NWMN_0523 sdrC Ser-Asp rich fibrinogen/bone sialoprotein-binding protein SdrC