Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 126772
End position: 126795
Length: 24

DNA sequence
>NC_009706, from 126772 to 126795 (24 bp); Clostridium kluyveri DSM 555 TTTATACTTATATTTATTATTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 125926-126966	Sequence	CKL_0135 - hypothetical protein (Protein is coded in complementary strand; from 126966 to 125926)