Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 1667242
End position: 1667265
Length: 24

DNA sequence
>NC_009706, from 1667242 to 1667265 (24 bp); Clostridium kluyveri DSM 555 AAATATCAATATAAACATAATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1666802-1667350	Sequence	CKL_1588 - hypothetical protein (Protein is coded in complementary strand; from 1667350 to 1666802)