Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 1731160
End position: 1731183
Length: 24

DNA sequence
>NC_009706, from 1731160 to 1731183 (24 bp); Clostridium kluyveri DSM 555 AATATTAAAATTACTATTAAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1730885-1731964	Sequence	CKL_1648 - hypothetical protein (Protein is coded in complementary strand; from 1731964 to 1730885)