Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 190563
End position: 190586
Length: 24

DNA sequence
>NC_009706, from 190563 to 190586 (24 bp); Clostridium kluyveri DSM 555 TATTGTATTATTCTATTAGTGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 190467-191162	Sequence	CKL_0200 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase