Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 1935039
End position: 1935062
Length: 24

DNA sequence
>NC_009706, from 1935039 to 1935062 (24 bp); Clostridium kluyveri DSM 555 ATAATTATATTTATCATTATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1934956-1935399	Sequence	CKL_1829 - hypothetical protein (Protein is coded in complementary strand; from 1935399 to 1934956)