Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2403777
End position: 2403800
Length: 24

DNA sequence
>NC_009706, from 2403777 to 2403800 (24 bp); Clostridium kluyveri DSM 555 AAAATCAAAAACACAATCAAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403388-2404296	Sequence	CKL_2343 - hypothetical protein (Protein is coded in complementary strand; from 2404296 to 2403388)