Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2410362
End position: 2410385
Length: 24

DNA sequence
>NC_009706, from 2410362 to 2410385 (24 bp); Clostridium kluyveri DSM 555 TCTTTCTATTTCTCTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2409691-2411220	Sequence	CKL_2349 - sensory transduction histidine kinase (Protein is coded in complementary strand; from 2411220 to 2409691)