Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2611475
End position: 2611498
Length: 24

DNA sequence
>NC_009706, from 2611475 to 2611498 (24 bp); Clostridium kluyveri DSM 555 TACTGCAACTGCAACTGCTATTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2611341-2612399	Sequence	CKL_2534 - heavy metal resistance protein (Protein is coded in complementary strand; from 2612399 to 2611341)