Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2817890
End position: 2817913
Length: 24

DNA sequence
>NC_009706, from 2817890 to 2817913 (24 bp); Clostridium kluyveri DSM 555 TAAATATAAGTATAATTATTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2817847-2818722	Sequence	CKL_2743 livH hypothetical protein (Protein is coded in complementary strand; from 2818722 to 2817847)