Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2987298
End position: 2987321
Length: 24

DNA sequence
>NC_009706, from 2987298 to 2987321 (24 bp); Clostridium kluyveri DSM 555 AATCTCTTAATCTCATAATATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2985965-2987419	Sequence	CKL_2925 - hypothetical protein (Protein is coded in complementary strand; from 2987419 to 2985965)