Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 3194519
End position: 3194542
Length: 24

DNA sequence
>NC_009706, from 3194519 to 3194542 (24 bp); Clostridium kluyveri DSM 555 TTTCTTTTGCTTTTTCTTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3192817-3194997	Sequence	CKL_3131 relA RelA protein (Protein is coded in complementary strand; from 3194997 to 3192817)