Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2626296
End position: 2626320
Length: 25

DNA sequence
>NC_009706, from 2626296 to 2626320 (25 bp); Clostridium kluyveri DSM 555 TTATTTTATCTGATTTGATTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2626025-2626369	Sequence	CKL_2550 - hypothetical protein (Protein is coded in complementary strand; from 2626369 to 2626025)