Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 3876090
End position: 3876114
Length: 25

DNA sequence
>NC_009706, from 3876090 to 3876114 (25 bp); Clostridium kluyveri DSM 555 TATTTTATTCTTTTTCATTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3876034-3876321	Sequence	CKL_3824 - hypothetical protein (Protein is coded in complementary strand; from 3876321 to 3876034)