Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 473974
End position: 473998
Length: 25

DNA sequence
>NC_009706, from 473974 to 473998 (25 bp); Clostridium kluyveri DSM 555 ATTTTATTTAAATTTAGTTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 473988-474449	Sequence	CKL_0500 - hypothetical protein (Protein is coded in complementary strand; from 474449 to 473988)