Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 702016
End position: 702040
Length: 25

DNA sequence
>NC_009706, from 702016 to 702040 (25 bp); Clostridium kluyveri DSM 555 AAAATAACATAAAAGAAATTACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 699012-702074	Sequence	CKL_0709 - peptidase (Protein is coded in complementary strand; from 702074 to 699012)