Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2507053
End position: 2507079
Length: 27

DNA sequence
>NC_009706, from 2507053 to 2507079 (27 bp); Clostridium kluyveri DSM 555 CTCCTGTTGCTCCCGTTGCTCCGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2506119-2508668	Sequence	CKL_2427 - hypothetical protein (Protein is coded in complementary strand; from 2508668 to 2506119)