Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 34250
End position: 34279
Length: 30

DNA sequence
>NC_009706, from 34250 to 34279 (30 bp); Clostridium kluyveri DSM 555 TTTTTGAATCTTTTAGAAGCTTTTTTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 33889-34359	Sequence	CKL_0033 - hypothetical protein (Protein is coded in complementary strand; from 34359 to 33889)