Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2291583
End position: 2291615
Length: 33

DNA sequence
>NC_009706, from 2291583 to 2291615 (33 bp); Clostridium kluyveri DSM 555 CTTTTTTTCTTCTTTTTATCTGCAATTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2291541-2292389	Sequence	CKL_2247 - hypothetical protein (Protein is coded in complementary strand; from 2292389 to 2291541)