Sequence retrieval

Genome: Clostridium kluyveri DSM 555
Start position: 2119209
End position: 2119268
Length: 60

DNA sequence
>NC_009706, from 2119209 to 2119268 (60 bp); Clostridium kluyveri DSM 555 TACCTTCTTTTCTACCTTCTTTTCTGCCTTCTTTTCTACCTTCTTTTCTACCTTCTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2119046-2119837	Sequence	CKL_2083 - hypothetical protein (Protein is coded in complementary strand; from 2119837 to 2119046)