Sequence retrieval

Genome: Thermotoga sp. RQ2
Start position: 1537383
End position: 1537418
Length: 36

DNA sequence
>NC_010483, from 1537383 to 1537418 (36 bp); Thermotoga sp. RQ2 GGAAGAGGTTTTGGAAGAGGGCTTGGAAGAGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1537189-1537476	Sequence	TRQ2_1530 - 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein