Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 163496
End position: 163543
Length: 48

DNA sequence
>NC_010508, from 163496 to 163543 (48 bp); Burkholderia cenocepacia MC0-3 chromosome 1 CACGACCACGACCACGACCACGACCACGACCACGACCACGACCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 163215-165761	Sequence	Bcenmc03_0138 - heavy metal translocating P-type ATPase