Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 1933976
End position: 1933999
Length: 24

DNA sequence
>NC_010508, from 1933976 to 1933999 (24 bp); Burkholderia cenocepacia MC0-3 chromosome 1 CGGCGCCGGCGGCGGGGCCGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1933263-1934168	Sequence	Bcenmc03_1731 - MotA/TolQ/ExbB proton channel (Protein is coded in complementary strand; from 1934168 to 1933263)