Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2012968
End position: 2012991
Length: 24

DNA sequence
>NC_010508, from 2012968 to 2012991 (24 bp); Burkholderia cenocepacia MC0-3 chromosome 1 TTCTGCATCTGCTCCTGCATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2012899-2013465	Sequence	Bcenmc03_1812 - polyhydroxyalkonate synthesis repressor PhaR (Protein is coded in complementary strand; from 2013465 to 2012899)