Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2172230
End position: 2172254
Length: 25

DNA sequence
>NC_010508, from 2172230 to 2172254 (25 bp); Burkholderia cenocepacia MC0-3 chromosome 1 TCGCGCCGCGGCGCGTCGCCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2171234-2172379	Sequence	Bcenmc03_1951 - LuxR family transcriptional regulator (Protein is coded in complementary strand; from 2172379 to 2171234)