Sequence retrieval

Genome: Burkholderia cenocepacia MC0-3 chromosome 1
Start position: 2316824
End position: 2316877
Length: 54

DNA sequence
>NC_010508, from 2316824 to 2316877 (54 bp); Burkholderia cenocepacia MC0-3 chromosome 1 GGCGCCGGCGCGTACACGGGCGCCGGTGCATAGACGGGCGCCGGCTGGTAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2316680-2317036	Sequence	Bcenmc03_2082 - hypothetical protein (Protein is coded in complementary strand; from 2317036 to 2316680)